Welcome to OligoWalk

OligoWalk is an online sever calculating thermodynamic features of sense-antisense hybidization. It predicts the free energy changes of oligonucleotides binding to a target RNA. It can be used to design efficient siRNA targeting a given mRNA sequence. The source code of OligoWalk for siRNA design can be downloaded from here.
The efficient siRNA selection method is described in a published paper (link). More references are listed in the Help page.

The server has been tested on Firefox 2 and Internet Explorer 7.

 
					
					
                         Target RNA Sequence  
					
                    
                        *Sequence name 
					     
						   						
                     
					 *Primary sequence
			
					
				
				Each T nucleotide will be converted to U

					 
				      
					 
					 
                        paste the sequence here 
					     
GCUAUUUUGGUGGAAUUGGUAGACACGAUA
CUCUUAAGAUGUAUUACUUUACAGUAUGAA
GGUUCAAGUCCUUUAAAUAGCACCA
				
                     
                    
                        or upload the sequence file (file format: fasta) 
					     
						   
						
                     

					   
					                        *Email address

Do not use file uploading, please paste your sequence above for

The fields indicated with an asterisk (*) are required.


					
					 
					
                    
					
                        Oligomer Options  
					
                      
                        Oligomer Type 
						 
							
					
					
				Only RNA oligo is available now.
						
		
                      
                      
                        Oligomer Length
                        
													
                      
                      
                        Oligomer Concentration
                        
						 
 					     
                    
				
				
				Please enter integer number
				
					   
                      
					  
					  
					  
                          Target Options 
												
					  
					    
                           Prefilter nonfunctional siRNA candidates 
				
					
				
				Prefilter must be selected if target structure needs to be broken or refolded in 'Binding Mode'.
				

						
						 
						 
   
					
						
												
					  
					    
                    
					  
					  
					  
                         Binding mode
                        
						  
						
                      
					  
                         Folding option
                        
						   
						
                      
					
					  
                        Folding size
                        
						   
						
					
				
				The folding size has a limitation of 1000 nucleotides. Please download the software for larger folding size.
				

		     
					     
					      
                     	
                      
					
					  
                         Scan region 
						
                        


						   
						   -- 
                          
					
					
				The scan region must be less than 1000 nucleotides if siRNA prefilter is not selected. Please download the software if you need longer scan region.


                     	
                      
					
                        Output Options  
					
					 
                        Output siRNA candidates selected by SVM

Use the default if you do not understand the options.
The usage of different options are explained in the Help page.

Visitors:

Oligomer Options
Oligomer Type	Only RNA oligo is available now.
Oligomer Length
Oligomer Concentration	Please enter integer number
Target Options
Prefilter nonfunctional siRNA candidates Prefilter must be selected if target structure needs to be broken or refolded in 'Binding Mode'.
Binding mode
Folding option
Folding size	The folding size has a limitation of 1000 nucleotides. Please download the software for larger folding size.
Scan region	-- The scan region must be less than 1000 nucleotides if siRNA prefilter is not selected. Please download the software if you need longer scan region.
Output Options
Output siRNA candidates selected by SVM

Target RNA Sequence
*Sequence name
*Primary sequence Each T nucleotide will be converted to U
paste the sequence here	GCUAUUUUGGUGGAAUUGGUAGACACGAUA CUCUUAAGAUGUAUUACUUUACAGUAUGAA GGUUCAAGUCCUUUAAAUAGCACCA
or upload the sequence file (file format: fasta)

*Email address